Review



cfx connect real time system  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad cfx connect real time system
    Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 15572 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
    Average 99 stars, based on 15572 article reviews
    cfx connect real time system - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Quantitative RT-PCR:

    Article Title: Histone lactylation modification promotes docetaxel resistance and tumor progression through CNN1-Mediated autophagy and cell cycle arrest in Castration-resistant prostate cancer.
    Article Snippet: RNA was converted to cDNA utilizing the SweScript All-in-One RT SuperMix (G3337, Servicebio, Wuhan, China). .. Real-time RT-PCR was conducted on a BioRad CFX Connect Real-Time PCR System using SYBR Green qPCR Master Mix (G3320, Servicebio, Wuhan, AR TI CL E IN P RE SS China). ..

    Article Title: miRNA Sequencing and Differential Analysis of Testis in 1-Year-Old and 2-Year-Old Kazakh Horses.
    Article Snippet: .. Quantitative RT-qPCR was conducted using a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA), with triplicate measurements for each sample. ..

    Article Title: TRIM7 inhibits rabies virus replication by promoting K48-linked ubiquitination and degradation of RABV-M
    Article Snippet: The extracted RNA was reverse-transcribed to complementary DNA using RT-qPCR Fast Master Mix (Vazyme, China). .. RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) following the instructions of SYBR Green Master Mix (Vazyme Biotech). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Histone lactylation modification promotes docetaxel resistance and tumor progression through CNN1-Mediated autophagy and cell cycle arrest in Castration-resistant prostate cancer.
    Article Snippet: RNA was converted to cDNA utilizing the SweScript All-in-One RT SuperMix (G3337, Servicebio, Wuhan, China). .. Real-time RT-PCR was conducted on a BioRad CFX Connect Real-Time PCR System using SYBR Green qPCR Master Mix (G3320, Servicebio, Wuhan, AR TI CL E IN P RE SS China). ..

    Article Title: Pulsed Electric Fields as an Effective Tool for Toxoplasma gondii Inactivation.
    Article Snippet: Thirty milligrams of mouse brain or heart were homogenized in 300 μL of lysis buffer (Promega, Madison, WI, USA) and 37 μL of Proteinase K (Promega, Madison, WI, USA) using plastic hand-pestle rotating plungers in an Eppendorf, and subsequently incubated at 70 ◦C for 30 min. DNA extraction was performed using a Maxwell 16 Lev Blood DNA Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions. .. Amplification and detection of T. gondii were performed using a CFX Connect real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with GoTaq SYBR Green Master Mix (catalogue # A6002, Promega) and the primers listed in Table 1. ..

    Article Title: White Adipose Tissue as a Functional Target of Secondary Bile Acids in Rainbow Trout ( Oncorhynchus mykiss )
    Article Snippet: Then, 2 μg of RNA were reverse transcribed into complementary DNA (cDNA) in a 20 μL reaction using the GoScriptTM Reverse Transcription Mix with Random Primers (Promega, Madison, WI, USA), according to the supplied protocol. .. Quantitative real-time PCR (RT-qPCR) was performed on a CFX Connect Real-Time PCR system (Bio-Rad, Hercules, CA, USA) using MAXIMA SYBR Green qPCR Master Mix (Life Technologies). ..

    Article Title: Biomimetic flowing vessel-on-a-chip recruiting glycocalyx features for investigating dexmedetomidine function
    Article Snippet: Fluorescence imaging was performed using an inverted fluorescent microscope (Zeiss Axio Vert.A1, Germany) and a confocal microscope (Nikon A1, Japan). .. Quantitative real-time PCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, USA). ..

    Article Title: miRNA Sequencing and Differential Analysis of Testis in 1-Year-Old and 2-Year-Old Kazakh Horses.
    Article Snippet: .. Quantitative RT-qPCR was conducted using a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA), with triplicate measurements for each sample. ..

    Article Title: Surveillance on California dairy farms reveals multiple possible sources of H5N1 influenza virus transmission.
    Article Snippet: Lysis buffer was then added to the pre-aliquoted samples in BSL3 and subsequent nucleic acid extraction was performed in the BSL2 lab (per approved biosafety protocols) using the NucleoMag RNA kit (Machery-Nagel) on an EpMotion 5075 (Eppendorf), with inclusion of a negative extraction control (PBS) in each extraction run. .. Viral detection required both sample replicates to each exhibit amplification (have CT values) using H5 HA-specific primers TATAGARGGAGGATGGCAGG and ACDGCCTCAAAYTGAGTGTT and probe FAM-AGGGGAGTGGKTACGCTGCRGAC- Black hole quencher, with the iTaq Universal Probes One-Step kit (Bio-Rad, Cat. No. 1725141) on a CFX Connect real-time PCR system (Bio-Rad) using published primers and cycling conditions [37,38]. ..

    Article Title: TRIM7 inhibits rabies virus replication by promoting K48-linked ubiquitination and degradation of RABV-M
    Article Snippet: The extracted RNA was reverse-transcribed to complementary DNA using RT-qPCR Fast Master Mix (Vazyme, China). .. RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) following the instructions of SYBR Green Master Mix (Vazyme Biotech). ..

    Article Title: Epigenetic Regulation of Immune Dysfunction in Chronic Prostatitis/Chronic Pelvic Pain Syndrome.
    Article Snippet: .. Total RNA was extracted from the VB3 cells with TRIzol reagent (Invitrogen) and reverse‐transcribed with qScript cDNA SuperMix (QuantaBio) following the manufacturers' protocols. qRT‐PCR reactions were prepared with PerfeCTa SYBR Green SuperMix (QuantaBio) and run on a CFX Connect Real‐Time PCR System (Bio‐Rad). .. Appropriate primers that specifically amplified human CD4 (forward sequence‐CCTCCTGCTTTTCATTGGGCTAG, reverse sequence ‐TGAGGACACTGGCAGGTCTTCT Origene), T‐ bet, GATA‐3, RORγT, and FOXP3 were selected based on previously published and validated primer sets [28].

    SYBR Green Assay:

    Article Title: Histone lactylation modification promotes docetaxel resistance and tumor progression through CNN1-Mediated autophagy and cell cycle arrest in Castration-resistant prostate cancer.
    Article Snippet: RNA was converted to cDNA utilizing the SweScript All-in-One RT SuperMix (G3337, Servicebio, Wuhan, China). .. Real-time RT-PCR was conducted on a BioRad CFX Connect Real-Time PCR System using SYBR Green qPCR Master Mix (G3320, Servicebio, Wuhan, AR TI CL E IN P RE SS China). ..

    Article Title: Pulsed Electric Fields as an Effective Tool for Toxoplasma gondii Inactivation.
    Article Snippet: Thirty milligrams of mouse brain or heart were homogenized in 300 μL of lysis buffer (Promega, Madison, WI, USA) and 37 μL of Proteinase K (Promega, Madison, WI, USA) using plastic hand-pestle rotating plungers in an Eppendorf, and subsequently incubated at 70 ◦C for 30 min. DNA extraction was performed using a Maxwell 16 Lev Blood DNA Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions. .. Amplification and detection of T. gondii were performed using a CFX Connect real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with GoTaq SYBR Green Master Mix (catalogue # A6002, Promega) and the primers listed in Table 1. ..

    Article Title: White Adipose Tissue as a Functional Target of Secondary Bile Acids in Rainbow Trout ( Oncorhynchus mykiss )
    Article Snippet: Then, 2 μg of RNA were reverse transcribed into complementary DNA (cDNA) in a 20 μL reaction using the GoScriptTM Reverse Transcription Mix with Random Primers (Promega, Madison, WI, USA), according to the supplied protocol. .. Quantitative real-time PCR (RT-qPCR) was performed on a CFX Connect Real-Time PCR system (Bio-Rad, Hercules, CA, USA) using MAXIMA SYBR Green qPCR Master Mix (Life Technologies). ..

    Article Title: TRIM7 inhibits rabies virus replication by promoting K48-linked ubiquitination and degradation of RABV-M
    Article Snippet: The extracted RNA was reverse-transcribed to complementary DNA using RT-qPCR Fast Master Mix (Vazyme, China). .. RT-qPCR was performed on a CFX Connect Real-Time PCR System (Bio-Rad, Hercules, CA, USA) following the instructions of SYBR Green Master Mix (Vazyme Biotech). ..

    Article Title: Epigenetic Regulation of Immune Dysfunction in Chronic Prostatitis/Chronic Pelvic Pain Syndrome.
    Article Snippet: .. Total RNA was extracted from the VB3 cells with TRIzol reagent (Invitrogen) and reverse‐transcribed with qScript cDNA SuperMix (QuantaBio) following the manufacturers' protocols. qRT‐PCR reactions were prepared with PerfeCTa SYBR Green SuperMix (QuantaBio) and run on a CFX Connect Real‐Time PCR System (Bio‐Rad). .. Appropriate primers that specifically amplified human CD4 (forward sequence‐CCTCCTGCTTTTCATTGGGCTAG, reverse sequence ‐TGAGGACACTGGCAGGTCTTCT Origene), T‐ bet, GATA‐3, RORγT, and FOXP3 were selected based on previously published and validated primer sets [28].

    Amplification:

    Article Title: Pulsed Electric Fields as an Effective Tool for Toxoplasma gondii Inactivation.
    Article Snippet: Thirty milligrams of mouse brain or heart were homogenized in 300 μL of lysis buffer (Promega, Madison, WI, USA) and 37 μL of Proteinase K (Promega, Madison, WI, USA) using plastic hand-pestle rotating plungers in an Eppendorf, and subsequently incubated at 70 ◦C for 30 min. DNA extraction was performed using a Maxwell 16 Lev Blood DNA Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions. .. Amplification and detection of T. gondii were performed using a CFX Connect real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with GoTaq SYBR Green Master Mix (catalogue # A6002, Promega) and the primers listed in Table 1. ..

    Article Title: Surveillance on California dairy farms reveals multiple possible sources of H5N1 influenza virus transmission.
    Article Snippet: Lysis buffer was then added to the pre-aliquoted samples in BSL3 and subsequent nucleic acid extraction was performed in the BSL2 lab (per approved biosafety protocols) using the NucleoMag RNA kit (Machery-Nagel) on an EpMotion 5075 (Eppendorf), with inclusion of a negative extraction control (PBS) in each extraction run. .. Viral detection required both sample replicates to each exhibit amplification (have CT values) using H5 HA-specific primers TATAGARGGAGGATGGCAGG and ACDGCCTCAAAYTGAGTGTT and probe FAM-AGGGGAGTGGKTACGCTGCRGAC- Black hole quencher, with the iTaq Universal Probes One-Step kit (Bio-Rad, Cat. No. 1725141) on a CFX Connect real-time PCR system (Bio-Rad) using published primers and cycling conditions [37,38]. ..

    Reverse Transcription:

    Article Title: Epigenetic Regulation of Immune Dysfunction in Chronic Prostatitis/Chronic Pelvic Pain Syndrome.
    Article Snippet: .. Total RNA was extracted from the VB3 cells with TRIzol reagent (Invitrogen) and reverse‐transcribed with qScript cDNA SuperMix (QuantaBio) following the manufacturers' protocols. qRT‐PCR reactions were prepared with PerfeCTa SYBR Green SuperMix (QuantaBio) and run on a CFX Connect Real‐Time PCR System (Bio‐Rad). .. Appropriate primers that specifically amplified human CD4 (forward sequence‐CCTCCTGCTTTTCATTGGGCTAG, reverse sequence ‐TGAGGACACTGGCAGGTCTTCT Origene), T‐ bet, GATA‐3, RORγT, and FOXP3 were selected based on previously published and validated primer sets [28].



    Similar Products

    99
    Bio-Rad cfx connect real time system
    Cfx Connect Real Time System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13092056-119-26-30
    Average 99 stars, based on 1 article reviews
    cfx connect real time system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad real time pcr detection system
    Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc12963995-402-8-14
    Average 99 stars, based on 1 article reviews
    real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx opus real time pcr system
    Cfx Opus Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13156693-293-20-25
    Average 99 stars, based on 1 article reviews
    cfx opus real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Fisher Scientific 1738 m165fc stereomicroscope leica n a dfc295 color digital camera leica n a cfx connect real time pcr system biorad cfx maestro 2 0
    1738 M165fc Stereomicroscope Leica N A Dfc295 Color Digital Camera Leica N A Cfx Connect Real Time Pcr System Biorad Cfx Maestro 2 0, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/pcr+real+system+time/pm42275222-211-99-129
    Average 86 stars, based on 1 article reviews
    1738 m165fc stereomicroscope leica n a dfc295 color digital camera leica n a cfx connect real time pcr system biorad cfx maestro 2 0 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Bio-Rad real time pcr system
    Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13158610-60-5-8
    Average 99 stars, based on 1 article reviews
    real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connecttm real time pcr detection system
    Cfx Connecttm Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc12999302-75-9-15
    Average 99 stars, based on 1 article reviews
    cfx connecttm real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    98
    Bio-Rad bio rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Bio Rad Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Maestro+Software/pmc12930076-116-7-7
    Average 98 stars, based on 1 article reviews
    bio rad cfx connect real time pcr detection system - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connect real time pcr detection system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Cfx Connect Real Time Pcr Detection System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13091559-79-17-23
    Average 99 stars, based on 1 article reviews
    cfx connect real time pcr detection system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cfx connect real time pcr system
    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad <t>CFX</t> <t>Connect</t> <t>Real-Time</t> <t>PCR</t> Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .
    Cfx Connect Real Time Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cfx+connect+real+time+pcr+system/CFX+Connect+Real-Time+PCR+Detection+System+Firmware+Update/pmc13148005-206-7-12
    Average 99 stars, based on 1 article reviews
    cfx connect real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Journal: Current Research in Structural Biology

    Article Title: Screening for novel chemical scaffolds targeting PCNA identifies the Hsp90alpha inhibitor SNX-2112

    doi: 10.1016/j.crstbi.2026.100183

    Figure Lengend Snippet: PCNA AI-CADD molecule thermal shift assay screening hits . AI-CADD screening: Left , plot of normalized melt curves of compounds + PCNA melt. Center , normalized derivative RFU of melt curve data. The DMSO control is plotted in black dashed lines. Right , . Calculated Δ Tm values of 19 AI-CADD hits. Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM. The reaction plates were heated from 25 °C to 95 °C with heating increments of 0.5 °C/min. Fluorescence intensity was measured within the excitation/emission ranges 470–505/540–700 nm. A negative control of 100% DMSO was included in each assay to obtain an apo- PCNA melting temperature (Tm apo ). The melting temperature of each reaction well was extrapolated from the midpoint of excitation of the produced melt curves by the CFX Maestro Software (Bio-Rad). The thermal shift values were calculated using the following equation: ΔTm = Tm + compound – Tm apo .

    Article Snippet: Thermal shift assays were performed using a Bio-Rad CFX Connect Real-Time PCR Detection System. and the final concentration of recombinant purified PCNA was 9 μM, and the final concentration of each compound was 1 mM.

    Techniques: Thermal Shift Assay, Control, Real-time Polymerase Chain Reaction, Concentration Assay, Recombinant, Purification, Fluorescence, Negative Control, Produced, Maestro Software